View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13968_low_17 (Length: 322)
Name: NF13968_low_17
Description: NF13968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13968_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 81 - 306
Target Start/End: Original strand, 4713036 - 4713266
Alignment:
| Q |
81 |
ttaatgaggaataaataaatatataatgtacatatttggtaatgtaatttttatattatttatactaacctctttagagacttctaactctaagcaagac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713036 |
ttaatgaggaataaataaatatataatgtacatatttggtaatgtaatttttattttatttatactaacctctttagagacttctaactctaagcaagac |
4713135 |
T |
 |
| Q |
181 |
attgttgaaatcaaagaagttgagattgagattatgggtttgaaac-----aaaagttgagggtagtttactctagcagaggaaagtgaagggtgaagag |
275 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713136 |
attgttgaaatcaaagatgttgagattgagattatgggtttgaaacaaattaaaagttgagggtagtttactctagcagaggaaagtgaagggtgaagag |
4713235 |
T |
 |
| Q |
276 |
aataacaaaagttgttacacaaagacaattt |
306 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
4713236 |
aagaacaaaagttgttacacaaagacaattt |
4713266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University