View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13968_low_24 (Length: 240)

Name: NF13968_low_24
Description: NF13968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13968_low_24
NF13968_low_24
[»] chr7 (2 HSPs)
chr7 (62-223)||(49057741-49057902)
chr7 (62-207)||(6554651-6554795)
[»] chr8 (1 HSPs)
chr8 (80-114)||(40158350-40158384)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 62 - 223
Target Start/End: Complemental strand, 49057902 - 49057741
Alignment:
62 acattgaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct 161  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49057902 acattgaatcaacattgattgcagaacaaatgcaatgctggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct 49057803  T
162 gccgaaaatgataattttgcgtggctaaaattaatcgcatgcatcacacatgcaccctgtat 223  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||    
49057802 gccgaaaatgataattttgtgtggctaaaattaattgcatgcatcacacatgcaccctgtat 49057741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 62 - 207
Target Start/End: Original strand, 6554651 - 6554795
Alignment:
62 acattgaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct 161  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||| |||||||      
6554651 acatggaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcccagcttgattgtaccattctatcaggttagac 6554750  T
162 gccgaaaatgataat-tttgcgtggctaaaattaatcgcatgcatca 207  Q
     | ||||||||||||  ||||  |||||||||||||| ||| |||||    
6554751 tcagaaaatgataatgattgc--ggctaaaattaatcacatacatca 6554795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 114
Target Start/End: Complemental strand, 40158384 - 40158350
Alignment:
80 ttgcagaacaaatgcaatgttggatatgcattcat 114  Q
    |||||||||||||| ||||||||||||||||||||    
40158384 ttgcagaacaaatgtaatgttggatatgcattcat 40158350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University