View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13969_high_1 (Length: 296)
Name: NF13969_high_1
Description: NF13969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13969_high_1 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 44882788 - 44883065
Alignment:
| Q |
19 |
atattgacgtaaaactttagtttcaattttgggagagagttgattttagaattatagagtaaatttttacatatttatgaacaaggcattatagtaaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44882788 |
atattgacgtaaaactttagtttcaattttgggagagagttgattttagaattatagagtaaatttttacatatttatgaacaaggcattatagtaaacc |
44882887 |
T |
 |
| Q |
119 |
ttggtacttattgtggtgatatcacttgacttggaatgcataggtcatttataaaaggagtggagccgtgaatagcgggtgtgtgaggcttatgttctgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44882888 |
ttggtacttattgtggtgatatcacttgacttggaatgcataggtcatttataaaaggagtggagccgtgaatagatggtgtgtgaggcttatgttctgc |
44882987 |
T |
 |
| Q |
219 |
tgcatttttggattacatgacagcatattgaaagtgatcactgcagaattggagcatactgtcttgtgcttaaattaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44882988 |
tgcatttttggattacatgacagcatattgaaagtgatcactgcagaattggagcatactgtcttgtgctgaaattaa |
44883065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University