View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13969_high_1_N (Length: 389)
Name: NF13969_high_1_N
Description: NF13969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13969_high_1_N |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 39244135 - 39243757
Alignment:
| Q |
1 |
gtctgaatttctatttgacaattatatccataaaatctttgcaaactgccaatttatgtgttaaagttttgtccataacacacagctaacgaacattcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39244135 |
gtctgaatttctatttgacaattatatccataaaatctttgcaaactgccaatttatgtgttaaagttttgtccataacacacagctaacgaacattcca |
39244036 |
T |
 |
| Q |
101 |
atgcacaaaacacaattggtggtagtgacctctcgtatcacctctagaaataataaattaactttgtatgta---cttcnnnnnnnnngttaacttttga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
39244035 |
atgcacaaaacacaattggtggtagtgacctctcgtatcacctctagaaataataaattaactttgtatgtactccttttttttttttgttaacttttga |
39243936 |
T |
 |
| Q |
198 |
tgttggatccctacacagtttaaattacattacttttcccttgtcaactatttttaattaatcacgttttgagttcactcaatgtttattttttcaacga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
39243935 |
tgttggatccctacacagtttaaattacattactttttccttgtcaactatttttaattaatcacg-tttgaggtcgctcaatgtttattttttcaacga |
39243837 |
T |
 |
| Q |
298 |
caggtcactcatggttgatcttgtggtatctgtgctccttcgctttcatgggtcttgtggcacgtttcgacgtcttcctatg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39243836 |
caggtcactcatggttgatcttgtggtatctgtggtc--gcgctttcatgggtcttgtggcacgtttcgacgtcttcctatg |
39243757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University