View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13969_high_4 (Length: 317)
Name: NF13969_high_4
Description: NF13969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13969_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 47565883 - 47565572
Alignment:
| Q |
1 |
gttgaatcgaccaacttgcggcccctcatagtcctgttcgttcatgaagctgagttaggattctgttctactgtggaaaagaaatgacgattggaataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47565883 |
gttgaatcgaccaacttgcggcccctcatagtcctgttcgttcatgaagctgagttaggattctgttctactgtggaaaagaaatgacgattggaataac |
47565784 |
T |
 |
| Q |
101 |
gaaccatgcaataaggatcttagtcagcaatgtatacagtgaggattttcaactcattcctatctcgtcttgccctgtcatgccctgttttagacaagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47565783 |
gaaccatgcaataaggatcttagtcagcaatgtatacagtgaggattttcaactcattcctatctcgtcttgccctgccatgccctgttttagacaagtt |
47565684 |
T |
 |
| Q |
201 |
aatggtgggggtagagcaaagcgggacaggctgactagttttgtcacctatgaatttcatgtatcctaattgctttataaacttcatgtttgtattggtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47565683 |
aatggtgggggtagagcaaagcgggacaggctgacgagttttgtcacctatgaatttcatgtatcctaattgctttataaacttcatgtttgtattggtg |
47565584 |
T |
 |
| Q |
301 |
tcgccctctcat |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47565583 |
tcgccctctcat |
47565572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University