View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1396_high_26 (Length: 202)

Name: NF1396_high_26
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1396_high_26
NF1396_high_26
[»] chr1 (2 HSPs)
chr1 (59-189)||(42165625-42165755)
chr1 (81-171)||(5481171-5481261)
[»] chr3 (1 HSPs)
chr3 (81-166)||(47170183-47170268)


Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 59 - 189
Target Start/End: Complemental strand, 42165755 - 42165625
Alignment:
59 aacctagggtagagagagtggttggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaaca 158  Q
    ||||||||| ||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
42165755 aacctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaaca 42165656  T
159 gcttcttagtcgttgtgttgatattggcata 189  Q
     ||||||| || |||| || |||||||||||    
42165655 acttcttactcattgtcttaatattggcata 42165625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 81 - 171
Target Start/End: Complemental strand, 5481261 - 5481171
Alignment:
81 tggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaacagcttcttagtcgt 171  Q
    ||||||||| ||||||||| ||||||| || ||||| || ||||||||||| |  |||||| | ||||||| |||||| ||||||| ||||    
5481261 tggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgt 5481171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 166
Target Start/End: Original strand, 47170183 - 47170268
Alignment:
81 tggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaacagcttctta 166  Q
    ||||||||||||||||||  |||| || || |||||||||||||| ||||||||||| ||| || |||||| ||||||||||||||    
47170183 tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttctta 47170268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University