View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_1 (Length: 611)
Name: NF1396_low_1
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 7e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 7e-66
Query Start/End: Original strand, 6 - 137
Target Start/End: Complemental strand, 42165755 - 42165624
Alignment:
| Q |
6 |
aacctagggtagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaaca |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165755 |
aacctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaaca |
42165656 |
T |
|
| Q |
106 |
acttcttactcattgtcttaatattggcatat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42165655 |
acttcttactcattgtcttaatattggcatat |
42165624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 23 - 116
Target Start/End: Complemental strand, 5481266 - 5481173
Alignment:
| Q |
23 |
atggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttactc |
116 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| || ||||| || ||||||||||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
5481266 |
atgggtggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactc |
5481173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 3e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 28 - 114
Target Start/End: Original strand, 47170183 - 47170269
Alignment:
| Q |
28 |
tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttac |
114 |
Q |
| |
|
|||||||||||||||||| ||||| || || |||||||||||||| ||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
47170183 |
tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttac |
47170269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University