View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_15 (Length: 412)
Name: NF1396_low_15
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 6 - 361
Target Start/End: Complemental strand, 39962787 - 39962438
Alignment:
| Q |
6 |
ggatgtgggacttgtcaactttcattagccaaacaaacgaaaatagtgatggagcggttaacttccatcgattcaacaacatctctctctcacgccaagt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
39962787 |
ggatgtgggacttgtcaactttcattagccaaacaaacaaaaatagtgatggagcggttaacttccatcgattcaaca---tctctctctcacgccgagt |
39962691 |
T |
|
| Q |
106 |
tttacgcacttactctctatgatctcttccctcaaccttcactttaggttggttggttggtcagtggggaagtaggaggtagattgctgatgctgctgat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39962690 |
tttacgcacttactctctatgatctcttccctcaaccttcactttaggttggttggttggtcagtggggaagtagg---tagattgctgatgctgctgat |
39962594 |
T |
|
| Q |
206 |
tttggagatgtgttgtgttgcatggaaacttctccttagttcaagaggaaagatggccgtgcttggatttattgcggcagatatacctaggtctaatcta |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39962593 |
tttggagatgtgttgtgttgcatggaaacttctcctttgttcaagaggaaagatggccgtgcttggatttattgcggcagatatacctaggtctaatcta |
39962494 |
T |
|
| Q |
306 |
nnnnnnnnnnnnnnattcttataccttaggataacacatttatatcatttgcatca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39962493 |
tttttttggtttttattcttataccttaggataacacatttatataatttgcatca |
39962438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 187 - 290
Target Start/End: Complemental strand, 1742386 - 1742280
Alignment:
| Q |
187 |
gattgctgatgctgctgattttggagatgtgttgtgtt--gcatggaaacttctccttagttc-aagaggaaagatggccgtgcttggatttattgcggc |
283 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||| || | |||||| ||||| ||||||| |||||||||||||| |||||||||||||||||| || |
|
|
| T |
1742386 |
gattgttgatgcttctgattttggtgatgtgttgcctttgggatggaagcttcttcttagtttgaagaggaaagatggtcgtgcttggatttattgccgc |
1742287 |
T |
|
| Q |
284 |
agatata |
290 |
Q |
| |
|
||||||| |
|
|
| T |
1742286 |
agatata |
1742280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University