View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_20 (Length: 350)
Name: NF1396_low_20
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 72 - 255
Target Start/End: Original strand, 47319877 - 47320060
Alignment:
| Q |
72 |
gtgatatgaaatataatcctaacatgttttccttcacacaataatgctaacatgttgaagtgcacaatataagttttgttcaagaaaatataagttcgat |
171 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47319877 |
gtgatgtgaaatataatcctaacatgttttccttcacacaataatgctaacatgttgaagtgcacaatataagttttgttcaagaaaatataagtttgat |
47319976 |
T |
|
| Q |
172 |
ttttggataaacaattttttgctaggtcttatttattttttgactaaactctaaattaccagagccattttctcttgagaataa |
255 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
47319977 |
ttttggataaacaattttttgctagactttatttattttttgactaaactttaaattaccagagccgttttctcttgagaataa |
47320060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University