View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_24 (Length: 325)
Name: NF1396_low_24
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 48888400 - 48888713
Alignment:
| Q |
1 |
tgcatgcatacaaacatcatatatgtaaggaggaacatgttatgaatttatttgtgctattttagatgttcagtgctgctatttacattctagtttaaat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48888400 |
tgcatgcatacaaatatcatatatgtaaggaggaacatgttatgaatttatttgtgctattttagatgttcagtactgctatttacattctagtttaaat |
48888499 |
T |
|
| Q |
101 |
taagtnnnnnnnnttacaggttcttactgtctctgctgacaagtctgcaaaagtgtgggatattgatgagaatggtagtggaacagtacataagacattg |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888500 |
taagtaaaaaaaattacaggttcttactgtctctgctgacaagtctgcaaaagtgtgggatattgatgagaatggtagtggaacagtacataagacattg |
48888599 |
T |
|
| Q |
201 |
gcacatcctgaatctggtggggtggaggacatgctcgttggttgtctttggcagaatgatcatctgcttactgtctcccttggtggcacgattagtttat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888600 |
gcacatcctgaatctggtggggtggaggacatgctcgttggttgtctttggcagaatgatcatctgcttactgtctcccttggtggcacgattagtttat |
48888699 |
T |
|
| Q |
301 |
actctgctaaggat |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48888700 |
actctgctaaggat |
48888713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University