View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_32 (Length: 293)
Name: NF1396_low_32
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 72 - 239
Target Start/End: Complemental strand, 49584322 - 49584155
Alignment:
| Q |
72 |
cgaccagaacaacttcattggattttacatcatcaacatgggggcatataagatcnnnnnnncctttaccgattgctaatccatcaacaagggctttgag |
171 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584322 |
cgaccagaacagcttcattggattttacatcatcaacatgggggcatataagatctttttttcctttaccgattgctaatccatcaacaagggctttgag |
49584223 |
T |
|
| Q |
172 |
cccaattaaatttttcagagtcgaaaaataatcttctggactaatgttcctttctgcaagtgtctctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49584222 |
cccaattaaatttttcagagtcgaaaaataatcttctggactaatgttcctctctgcaagtgtctctg |
49584155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University