View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_33 (Length: 290)
Name: NF1396_low_33
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 30 - 179
Target Start/End: Complemental strand, 48344910 - 48344761
Alignment:
| Q |
30 |
gtgatttggctttgtacattgattctgtttcggaggaggacgataataaaccacttgaatctgaagaacttgaagttgagctgaaaaacataacatcttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48344910 |
gtgatttggctttgtacattgattctgtttcggaggaggatgataataaaccacttgaatctgaagaacttgaagttgagctgaaaaacataacatcttg |
48344811 |
T |
|
| Q |
130 |
gtcatgaatctcatgatcaagatgcaactttctgtctatttgtgtagtga |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48344810 |
gtcatgaatctcatgatcaagatgcaactttctgtctatttgtgttgtga |
48344761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 48344685 - 48344643
Alignment:
| Q |
237 |
ttttgctctgtttttgaaatgttgtttctgtatagaagttcat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48344685 |
ttttgctctgtttttgaaatgttgtttctgtatagaacttcat |
48344643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 237
Target Start/End: Complemental strand, 48344743 - 48344703
Alignment:
| Q |
197 |
caaacaccgcgaagatatggttgttgttcttcaacaactct |
237 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
48344743 |
caaacaccgcgaagatatggttgctgttcttcaaaaactct |
48344703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University