View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_36 (Length: 285)
Name: NF1396_low_36
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2389758 - 2389978
Alignment:
| Q |
1 |
agcctctcaatttatctcggttattcttctcagtcccccaaattcataggtaaaatgctggctgtgatgttagtaaagtatagaagataaagcgcgtcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389758 |
agcctctcaatttatctcggttattcttctcagtcccccaaattcataagtaaaatgctggctgtgatgttagtaaagtatagaagataaagcgcgtcgc |
2389857 |
T |
 |
| Q |
101 |
acctatgtggccatatcttcatatcatcttcagatggtttgagcagcaagtcgatgcaagcttttccatttgaatctgtgggcagcggtggaggattttg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389858 |
acctatgtggccatatcttcatatcgtcttcagatggtttgagcagcaagtcgatgcaagcttttccatttgaatctgtgggcagcggtggaggattttg |
2389957 |
T |
 |
| Q |
201 |
atcaataacccatatcttatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2389958 |
atcaataacccatatcttatt |
2389978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University