View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1396_low_42 (Length: 235)

Name: NF1396_low_42
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1396_low_42
NF1396_low_42
[»] chr8 (2 HSPs)
chr8 (1-163)||(8711489-8711651)
chr8 (1-73)||(8735900-8735972)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 8711489 - 8711651
Alignment:
1 gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggcgaaggatgaaacctggggatcaagaataaggtat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
8711489 gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggcgaaggatgaaacctggggatcaagaataagttat 8711588  T
101 catagtgagaagtgtctttggaatcaagagcaagaatagaatactccctcatcctataagagt 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
8711589 catagtgagaagtgtctttggaatcaagagcaagaatagaatactccctcatcctataggagt 8711651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 8735900 - 8735972
Alignment:
1 gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggcgaaggat 73  Q
    ||||||||||||| | |||| | ||||||||||||||| ||||||||||||||||| || |||| | ||||||    
8735900 gaaattgacaaagttttattgtgctttttgtgggaaaaagtggagcaaataattgacatggtggcccaaggat 8735972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University