View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_45 (Length: 218)
Name: NF1396_low_45
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 9 - 127
Target Start/End: Complemental strand, 2687286 - 2687168
Alignment:
| Q |
9 |
tagcaacactctctaaacaccgtatcaatgttgtttccccacttcttgttgtacatctccaaaagcttataagctggtgtcatacctgcatgaccatata |
108 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2687286 |
tagcaacactctctaaacacaggatcaatgttgcttccccacttcttgttgtacatctccaaaagcttatcagctggtgtcatacctgcatgaccatata |
2687187 |
T |
 |
| Q |
109 |
tcgtttcatttcatctcac |
127 |
Q |
| |
|
| |||||||||||| |||| |
|
|
| T |
2687186 |
tagtttcatttcatgtcac |
2687168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 2694304 - 2694217
Alignment:
| Q |
9 |
tagcaacactctctaaacaccgtatcaatgttgtttccccacttcttgttgtacatctccaaaagcttataagctggtgtcatacctg |
96 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||| |||||||||| || |||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
2694304 |
tagcaacactctctaaacacagaatctatgttgcttccccacttgttattgtacatctccaaaagcttttcagccggtgtcatacctg |
2694217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University