View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_48 (Length: 203)
Name: NF1396_low_48
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 40 - 180
Target Start/End: Original strand, 42165615 - 42165755
Alignment:
| Q |
40 |
ggagagcagatatgccaatattaagacaatgagtaagaagttggttggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatg |
139 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165615 |
ggagagcaaatatgccaatattaagacaatgagtaagaagttgtttggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatg |
42165714 |
T |
 |
| Q |
140 |
cacagcaatagcccaaccaaccattttctctaccctaggtt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42165715 |
cacagcaatagcccaaccaaccattttctctgccctaggtt |
42165755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 42 - 163
Target Start/End: Original strand, 5481145 - 5481266
Alignment:
| Q |
42 |
agagcagatatgccaatattaagacaatgagtaagaagttggttggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatgca |
141 |
Q |
| |
|
|||||||| ||||||| ||| ||| | ||||||||||||| ||||||||||| |||||||| | ||||||||||| || ||||| || |||||||||| |
|
|
| T |
5481145 |
agagcagagatgccaagattgagaacacgagtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgca |
5481244 |
T |
 |
| Q |
142 |
cagcaatagcccaaccaaccat |
163 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
5481245 |
cagcaattgcccaaccacccat |
5481266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 72 - 158
Target Start/End: Complemental strand, 47170269 - 47170183
Alignment:
| Q |
72 |
gtaagaagttggttggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatgcacagcaatagcccaacca |
158 |
Q |
| |
|
|||||||| || |||||||||| |||||| ||||||||||| |||||||||||||| || || ||||| |||||||||||||||||| |
|
|
| T |
47170269 |
gtaagaagctgtttggcttcttgctgacggtgtggtgggaggttaggatccacacctgcaccgccatgaacagcaatagcccaacca |
47170183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University