View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396_low_49 (Length: 202)
Name: NF1396_low_49
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 59 - 189
Target Start/End: Complemental strand, 42165755 - 42165625
Alignment:
| Q |
59 |
aacctagggtagagagagtggttggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaaca |
158 |
Q |
| |
|
||||||||| ||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
42165755 |
aacctagggcagagaaaatggttggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaaca |
42165656 |
T |
 |
| Q |
159 |
gcttcttagtcgttgtgttgatattggcata |
189 |
Q |
| |
|
||||||| || |||| || ||||||||||| |
|
|
| T |
42165655 |
acttcttactcattgtcttaatattggcata |
42165625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 81 - 171
Target Start/End: Complemental strand, 5481261 - 5481171
Alignment:
| Q |
81 |
tggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaacagcttcttagtcgt |
171 |
Q |
| |
|
||||||||| ||||||||| ||||||| || ||||| || ||||||||||| | |||||| | ||||||| |||||| ||||||| |||| |
|
|
| T |
5481261 |
tggttgggcaattgctgtgcatggtggtgctggtgttgaccctaatctccctcttcaacgtcaagaagaagccaaacaacttcttactcgt |
5481171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 166
Target Start/End: Original strand, 47170183 - 47170268
Alignment:
| Q |
81 |
tggttgggctattgctgtggatggtggcgccggtgtggatcctaatctcccaccacaacgtgaggaagaagacaaacagcttctta |
166 |
Q |
| |
|
|||||||||||||||||| |||| || || |||||||||||||| ||||||||||| ||| || |||||| |||||||||||||| |
|
|
| T |
47170183 |
tggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttctta |
47170268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University