View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13970_high_17 (Length: 262)
Name: NF13970_high_17
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13970_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 86 - 243
Target Start/End: Complemental strand, 23097355 - 23097198
Alignment:
| Q |
86 |
ttttgtgtgcttctctttctaatgcaagtgatgatttattaacaccatcatttaatgatttgtttgccatatccattatgatattcacaaccatagttac |
185 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||| || |
|
|
| T |
23097355 |
ttttgtgtgtttctctttccaatgcaagtgatgatttattaacaccatcatttaatgattcgtttgccatatcctttatgatattcacaacaatagccac |
23097256 |
T |
|
| Q |
186 |
tattttcaaattcaaaaattattggctaacttggtaacttttattaaagggtgctatt |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
23097255 |
tattctcaaattcaaaaattattggctaacttagtaacttttattaaagggtgttatt |
23097198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 59
Target Start/End: Complemental strand, 23097581 - 23097551
Alignment:
| Q |
29 |
acaacattcccatgtcattggtagcgttggc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23097581 |
acaacattcccatgtcattggtagcgttggc |
23097551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University