View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13970_high_22 (Length: 204)

Name: NF13970_high_22
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13970_high_22
NF13970_high_22
[»] chr3 (1 HSPs)
chr3 (13-185)||(38484407-38484579)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 38484407 - 38484579
Alignment:
13 gataatactagaagggtttagagactagagtgatttcttttgaaataaaggaatgattaggtttgtgaaaaaccaaagtaggaagggaatgagatgcata 112  Q
    |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38484407 gataatactaaaagggtttagagactagagtggtttcttttgaaataaaggaatgattaggtttgtgaaaaaccaaagtaggaagggaatgagatgcata 38484506  T
113 ttttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtgggtata 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38484507 ttttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtgggtata 38484579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University