View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13970_high_7 (Length: 456)
Name: NF13970_high_7
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13970_high_7 |
 |  |
|
| [»] chr6 (6 HSPs) |
 |  |
|
| [»] chr7 (7 HSPs) |
 |  |
|
| [»] chr1 (7 HSPs) |
 |  |
|
| [»] chr8 (11 HSPs) |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
| [»] chr4 (14 HSPs) |
 |  |
|
| [»] chr3 (9 HSPs) |
 |  |
|
| [»] chr2 (7 HSPs) |
 |  |
|
| [»] scaffold0565 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 430; Significance: 0; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 456
Target Start/End: Complemental strand, 31234214 - 31233762
Alignment:
| Q |
1 |
attctagctggataaagtgcaggaagtttagggttgcggttaaggtgagtcatgggagtaatcaaagcattaggattcaagaaggcatgactgaggcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31234214 |
attctagctggataaagtgcaggaagtttagggttgcggttaaggtgagtcataggagtaatcaaagcattaggattcaagaaggcatgactgaggcatt |
31234115 |
T |
 |
| Q |
101 |
tgttgtgaaggatcatcgtggagaatgtaagttttattatcataattcataaacttggaattgtataaactataatatctttaacatgccttaatttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31234114 |
tgttgtgaaggatcatcgtggagaatgtaagttttattatcataattcataaacttggaattgtataaactataatatctttaacatgccttaatttttt |
31234015 |
T |
 |
| Q |
201 |
gtgtgtagaatcgtatataattgcaatattgattgggatatatttgatgacaatgactaaatagtacttatttccaactaactttggtctttttaaatta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31234014 |
gtgtgtagaatcgtatataattgcaatattgattgggatatatttgatgacaatgactaaa---cacttatttccaactaactttggtctttttaaatta |
31233918 |
T |
 |
| Q |
301 |
gttcttacacccttaaataaattaataagatggtcgccacttttgttgttgtagttttgttattgagcgtgtaaatattgtatatatttattgtatccgt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31233917 |
gttcttacacccttaaataaattaataagatggtccccacttttgttgttgtagttttgttattgagcgtgtaaatattgtatatatttattgtatccgt |
31233818 |
T |
 |
| Q |
401 |
tttaaaataattaagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31233817 |
tttaaaataattaagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
31233762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 31243351 - 31243215
Alignment:
| Q |
1 |
attctagctggataaagtgcaggaagtttagggttgcggttaaggtgagtcatgggagtaatcaaagcattaggattcaagaaggcatgactgaggcatt |
100 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| | ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31243351 |
attctagctggataccgtgcaggaaatttagggttgcagctaaagtgagtcatgtgagtaatcaaagcattaggattcaagaaggcatgactgaggcatt |
31243252 |
T |
 |
| Q |
101 |
tgttgtgaaggatcatcgtggagaatgtaagttttat |
137 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31243251 |
tgttgttaaggatcatcgtggagaatgtaagttttat |
31243215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 314 - 390
Target Start/End: Complemental strand, 31242805 - 31242729
Alignment:
| Q |
314 |
taaataaattaataagatggtcgccacttttgttgttgtagttttgttattgagcgtgtaaatattgtatatattta |
390 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||| |||||||||| ||| ||||||||| |||||||| |
|
|
| T |
31242805 |
taaatatattaataagatggtccccacttttgttgttgtagttatgttattgagtgtgcaaatattgtttatattta |
31242729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 190 - 286
Target Start/End: Complemental strand, 31243144 - 31243053
Alignment:
| Q |
190 |
cttaattttttgtgtgtagaatcgtatataattgcaatattgattgggatatatttgatgacaatgactaaatagtacttatttccaactaactttg |
286 |
Q |
| |
|
||||||||||||||| || || ||||| |||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31243144 |
cttaattttttgtgt--agcatgatatattattgcaatatagattggaatatatttgatgacaatgactaaa---cacttatttccaactaactttg |
31243053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Complemental strand, 34519303 - 34519263
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgt |
455 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34519303 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgt |
34519263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 31275821 - 31275778
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31275821 |
taagtgtcgctttagcaaaa-aaaaattgtttcaaaatgaatgtc |
31275778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 19105178 - 19105136
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19105178 |
agtgtcgttttagcaaaaaaaaaattgttttaaaatgaatgtc |
19105136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 27947678 - 27947636
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27947678 |
agtgtcgttttagcaaaaaaaaaattgtcttaaaatgaatgtc |
27947636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 45948807 - 45948765
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45948807 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
45948765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 13405304 - 13405262
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13405304 |
agtgtcgttttagttaaaaaaaaattgttttaaaatgaatgtc |
13405262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 23935396 - 23935438
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
23935396 |
agtgtcgttttaggaaaaaaaaaattgttttaaaataaatgtc |
23935438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 456
Target Start/End: Original strand, 27935742 - 27935783
Alignment:
| Q |
415 |
gtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27935742 |
gtgtcgttttagttaaaaaaaaattgttttaaaatgaatgtc |
27935783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 45933764 - 45933719
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaa-ttgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
45933764 |
taagtgtcgttttagtaaaaaaaaaaattgttttaaaatgaatgtc |
45933719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 413 - 456
Target Start/End: Complemental strand, 1740819 - 1740776
Alignment:
| Q |
413 |
aagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1740819 |
aagtgtcgttttagtaaaaaaaaaattgttttaaaatgaatgtc |
1740776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 34047412 - 34047370
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34047412 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
34047370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 12002221 - 12002262
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12002221 |
agtgtcgttttagctaaa-aaaaattgttttaaaatgaatgtc |
12002262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 48025430 - 48025389
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
48025430 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgtc |
48025389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 454
Target Start/End: Original strand, 48008980 - 48009024
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaa--attgttttaaaatgaatg |
454 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
48008980 |
taagtgtcgttttagcaaaaaaaaaaaattgttttaaaatgaatg |
48009024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 456
Target Start/End: Original strand, 6332139 - 6332182
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| | |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6332139 |
taagtgttgctttagcaaaa-aaaaattgttttaaaatgaatgtc |
6332182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 416 - 456
Target Start/End: Complemental strand, 18794716 - 18794676
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
18794716 |
tgtcgttttagcaaaaaaaatattgttttaaaataaatgtc |
18794676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 6374388 - 6374430
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6374388 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
6374430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 416 - 456
Target Start/End: Original strand, 17920933 - 17920972
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17920933 |
tgtcgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
17920972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 453
Target Start/End: Complemental strand, 6116183 - 6116145
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaat |
453 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6116183 |
agtgtcgttttagcaaaa-aaaaattgttttaaaatgaat |
6116145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 14234395 - 14234355
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14234395 |
agtgtcgttttagcaaaa--aaaattgttttaaaatgaatgtc |
14234355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 7839433 - 7839474
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7839433 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgtc |
7839474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 418 - 456
Target Start/End: Original strand, 9812152 - 9812189
Alignment:
| Q |
418 |
tcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9812152 |
tcgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
9812189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 14541924 - 14541882
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14541924 |
agtgtcgctttagcaaaaaaaaaattgtttcaaaatgaatgtc |
14541882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 35052446 - 35052487
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
35052446 |
agtgtcgctttagcaaaa-aaaaattgttttaaaatgaatgtc |
35052487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 81 - 135
Target Start/End: Original strand, 44028824 - 44028878
Alignment:
| Q |
81 |
gaaggcatgactgaggcatttgttgtgaaggatcatcgtggagaatgtaagtttt |
135 |
Q |
| |
|
||||||||||| || || |||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
44028824 |
gaaggcatgacagaagcttttgttgttaaggatcaccgtggagaatgtcagtttt |
44028878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 4760737 - 4760695
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
4760737 |
taagtgtcgttttagccaaa--aaaattgttttaaaatgaatgtc |
4760695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 5790872 - 5790829
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5790872 |
taagtgtcgttttagataaa-aaaaattgttttaaaatgaatgtc |
5790829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 6518950 - 6518992
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6518950 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
6518992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 34446206 - 34446164
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34446206 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
34446164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 416 - 456
Target Start/End: Complemental strand, 12167758 - 12167718
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
12167758 |
tgtcgctttagcaaaaaaaaaattgttttaaaatgaatgtc |
12167718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 42104242 - 42104200
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
42104242 |
agtgtcgttttagccaaaaaaaaattgtttcaaaatgaatgtc |
42104200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 14)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 396 - 456
Target Start/End: Complemental strand, 27943743 - 27943687
Alignment:
| Q |
396 |
tccgttttaaaataattaagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
27943743 |
tccgttttaaaata--taagtgtcgttttagcaaaa--aaaattgtttcaaaatgaatgtc |
27943687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 51733677 - 51733635
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
51733677 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaatgtc |
51733635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 52848236 - 52848195
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52848236 |
agtgtcgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
52848195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 455
Target Start/End: Original strand, 18429966 - 18430005
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgt |
455 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
18429966 |
tgtcgttttagcaaaaaaaaaattattttaaaatgaatgt |
18430005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 44572049 - 44572006
Alignment:
| Q |
414 |
agtgtcgttttagc-aaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44572049 |
agtgtcgttttagctaaaaaaaaaattgttttaaaatgaatgtc |
44572006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 17499898 - 17499856
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17499898 |
agtgtcgatttagcaaaaaaaaaattgtttcaaaatgaatgtc |
17499856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 25231150 - 25231191
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
25231150 |
agtgtcgctttagcaaaa-aaaaattgttttaaaatgaatgtc |
25231191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 28734572 - 28734614
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
28734572 |
agtgtcgttttagcaaaaaaaaaattgtttcataatgaatgtc |
28734614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 456
Target Start/End: Original strand, 31941537 - 31941571
Alignment:
| Q |
422 |
tttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
31941537 |
tttagcaaaaaaaaaattgttttaaaatgaatgtc |
31941571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 54042365 - 54042324
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54042365 |
agtgttgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
54042324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 416 - 456
Target Start/End: Original strand, 19930691 - 19930730
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19930691 |
tgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgtc |
19930730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 454
Target Start/End: Original strand, 30105893 - 30105932
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatg |
454 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
30105893 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatg |
30105932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 454
Target Start/End: Complemental strand, 32141143 - 32141103
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatg |
454 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
32141143 |
agtgtcgttttaacaaaaaaaaaattgtttcaaaatgaatg |
32141103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 50203053 - 50203092
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50203053 |
agtgtcgttttagcaaaa---aaattgttttaaaatgaatgtc |
50203092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 44648578 - 44648537
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44648578 |
agtgtcgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
44648537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 394 - 456
Target Start/End: Original strand, 47137922 - 47137979
Alignment:
| Q |
394 |
tatccgttttaaaataattaagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
47137922 |
tatccgttttaaaataat-----gtcgttttagtaaaaaaaaaattgttttaaaatgaatgtc |
47137979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 394 - 456
Target Start/End: Original strand, 27027692 - 27027750
Alignment:
| Q |
394 |
tatccgttttaaaataattaagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
27027692 |
tatccgttttaaaataa----gtgtcgttttagcaaaaaaaaaattgtttcaaaattaatgtc |
27027750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 416 - 456
Target Start/End: Complemental strand, 53200853 - 53200814
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53200853 |
tgtcgttttagcaaaa-aaaaattgttttaaaatgaatgtc |
53200814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 33194205 - 33194165
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33194205 |
agtgtcgttttagcaaaa--aaaattgttttaaaatgaatgtc |
33194165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 30934981 - 30934940
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30934981 |
agtgtcgttttagctaaa-aaaaattgttttaaaatgaatgtc |
30934940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Complemental strand, 50038346 - 50038305
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
50038346 |
agtgtcgctttagcaaaa-aaaaattgttttaaaatgaatgtc |
50038305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 452
Target Start/End: Complemental strand, 50088491 - 50088454
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaa |
452 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50088491 |
agtgtcgttttagcaaaa-aaaaattgttttaaaatgaa |
50088454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 412 - 456
Target Start/End: Original strand, 49470763 - 49470806
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
49470763 |
taagtgtcgctttagcaaaa-aaaaattgtttcaaaatgaatgtc |
49470806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 441412 - 441368
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
441412 |
taagtgtcgttttagccaaaaaaaaattgtttcaaaatgaatgtc |
441368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 453
Target Start/End: Original strand, 1422124 - 1422163
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaat |
453 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1422124 |
agtgtcgttttagcaaaaaaaaaattgtttcaaaatgaat |
1422163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 14697987 - 14698028
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14697987 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgtc |
14698028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 36177951 - 36177992
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36177951 |
agtgtcgttttagcaaaa-aaaaattgtttcaaaatgaatgtc |
36177992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 456
Target Start/End: Complemental strand, 45372702 - 45372668
Alignment:
| Q |
422 |
tttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
45372702 |
tttagcaaaaaaaaaattgttttaaaatgaatgtc |
45372668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 456
Target Start/End: Complemental strand, 9366298 - 9366256
Alignment:
| Q |
412 |
taagtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
9366298 |
taagtgtcgttttagcaaaa--aaaattgttttaaaataaatgtc |
9366256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 456
Target Start/End: Original strand, 38926583 - 38926622
Alignment:
| Q |
414 |
agtgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38926583 |
agtgtcgttttagcaaaa---aaattgttttaaaatgaatgtc |
38926622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 416 - 456
Target Start/End: Complemental strand, 9817 - 9778
Alignment:
| Q |
416 |
tgtcgttttagcaaaacaaaaattgttttaaaatgaatgtc |
456 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9817 |
tgtcgttttagccaaa-aaaaattgttttaaaatgaatgtc |
9778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University