View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13970_low_15 (Length: 277)
Name: NF13970_low_15
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13970_low_15 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 36203863 - 36203976
Alignment:
| Q |
15 |
aagattcatcacacaaactttctgaccctattcagagagaaattgctaaggttccctttctatacttttcagttttcttattgaatgtgaaatttcttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36203863 |
aagattcatcacacaaactttctgaccctaatcagagagaaattgctaaggttccctttctatacttttcagttttcttattgaacgtgaaatttcttca |
36203962 |
T |
|
| Q |
115 |
aatgtagtatcttg |
128 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36203963 |
aatgtagtatcttg |
36203976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 210 - 270
Target Start/End: Original strand, 36204060 - 36204120
Alignment:
| Q |
210 |
acttaggaaataaagcttgatccaagattgacatcatttattaagaaagataattcatttc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36204060 |
acttaggaaataaagcttgatccaagattgacatcatttattaagaaagataattcatttc |
36204120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 270
Target Start/End: Complemental strand, 249305 - 249249
Alignment:
| Q |
214 |
aggaaataaagcttgatccaagattgacatcatttattaagaaagataattcatttc |
270 |
Q |
| |
|
||||||||| | ||||| ||||||| ||||| ||| |||||||||||||||| |||| |
|
|
| T |
249305 |
aggaaataatgattgatgcaagattcacatcttttcttaagaaagataattcttttc |
249249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University