View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13970_low_19 (Length: 262)

Name: NF13970_low_19
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13970_low_19
NF13970_low_19
[»] chr6 (2 HSPs)
chr6 (86-243)||(23097198-23097355)
chr6 (29-59)||(23097551-23097581)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 86 - 243
Target Start/End: Complemental strand, 23097355 - 23097198
Alignment:
86 ttttgtgtgcttctctttctaatgcaagtgatgatttattaacaccatcatttaatgatttgtttgccatatccattatgatattcacaaccatagttac 185  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||  ||    
23097355 ttttgtgtgtttctctttccaatgcaagtgatgatttattaacaccatcatttaatgattcgtttgccatatcctttatgatattcacaacaatagccac 23097256  T
186 tattttcaaattcaaaaattattggctaacttggtaacttttattaaagggtgctatt 243  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
23097255 tattctcaaattcaaaaattattggctaacttagtaacttttattaaagggtgttatt 23097198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 59
Target Start/End: Complemental strand, 23097581 - 23097551
Alignment:
29 acaacattcccatgtcattggtagcgttggc 59  Q
    |||||||||||||||||||||||||||||||    
23097581 acaacattcccatgtcattggtagcgttggc 23097551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University