View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13970_low_20 (Length: 258)
Name: NF13970_low_20
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13970_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 256
Target Start/End: Original strand, 36204129 - 36204388
Alignment:
| Q |
6 |
tggagttgtgaccccaatgcttccaagaatgagcttggttctacttctaccaaagaaggagagaatctttcttttcttcctgaatcatattttagtcatg |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36204129 |
tggagttgggaccccaatgcttccaagaatgagcttggttctacttctaccaaag---gagagaatctttcttttcctcctgaatcatattttagtcatg |
36204225 |
T |
|
| Q |
106 |
aggtacttgtttttccttgtttaatgtccagctttttggtttccttcaaaacccttggactgtg------------tccttcttgccctttctggtcatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36204226 |
aggtacttgtttttccttgtttaatgtccagctttgtggtttccttcaaaacccttggactgtggttgctatgtaatccttcttgccctttctggtcatg |
36204325 |
T |
|
| Q |
194 |
attgtgttttgtacaatgcatgcatgtgatcaattgttaaaggatgttttggtatagaattat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36204326 |
attgtgttttgtacaatgcatgcatgtgatcaattgttaaaggatgttttggtatagaattat |
36204388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 251
Target Start/End: Complemental strand, 11068504 - 11068470
Alignment:
| Q |
217 |
atgtgatcaattgttaaaggatgttttggtataga |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11068504 |
atgtgatcaattgttaaagaatgttttggtataga |
11068470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University