View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13970_low_24 (Length: 204)
Name: NF13970_low_24
Description: NF13970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13970_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 38484407 - 38484579
Alignment:
| Q |
13 |
gataatactagaagggtttagagactagagtgatttcttttgaaataaaggaatgattaggtttgtgaaaaaccaaagtaggaagggaatgagatgcata |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484407 |
gataatactaaaagggtttagagactagagtggtttcttttgaaataaaggaatgattaggtttgtgaaaaaccaaagtaggaagggaatgagatgcata |
38484506 |
T |
|
| Q |
113 |
ttttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtgggtata |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484507 |
ttttgcggtgagtaatgatttcattttgtctgggaaaatgaagggggagaggatatgatttttggtgggtata |
38484579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University