View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13971_low_5 (Length: 241)
Name: NF13971_low_5
Description: NF13971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13971_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 114 - 240
Target Start/End: Original strand, 24665497 - 24665623
Alignment:
| Q |
114 |
gtttgtttcagattattcttgtgattatgtagtagaatctactaagataacataagtagatgtcaatttattaatgatttttactattttataatttgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24665497 |
gtttgtttcagattattcttgtgattatgtagtagaatctactaagataacataagtagatgtccatttattaatgatttttactattttataatttgtt |
24665596 |
T |
 |
| Q |
214 |
tatttctgtgtgtttcatattgttcat |
240 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
24665597 |
tatttctgtgtgtttcagattgttcat |
24665623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 24665408 - 24665457
Alignment:
| Q |
22 |
atgtgaaaccgtcattgtgtagtagaatgcataagataacattagtatat |
71 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24665408 |
atgtgaaaccgtcgttgtgtagtagaatgcataagataacattagtatat |
24665457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University