View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13971_low_8 (Length: 237)
Name: NF13971_low_8
Description: NF13971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13971_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 115 - 222
Target Start/End: Original strand, 8236064 - 8236171
Alignment:
| Q |
115 |
tagattgaactcctcaaatacttttggttgtccatgaaacaacatgtatgagatcgtttatgtaagtcagtatgaaaaaatctaactaataagtaaatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8236064 |
tagattgaactcctcaaatacttttggttgtccatgaaacaacatgtatgagatcctttatgtaagtcagtatgaaaaaatctaactaataagtaaatat |
8236163 |
T |
|
| Q |
215 |
gtatatct |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
8236164 |
gtatatct |
8236171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 8235950 - 8236019
Alignment:
| Q |
1 |
aattgaaatagatgacgcataaacaaagtaacaaannnnnnngtacaaagaaaatattttttattcaaga |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8235950 |
aattgaaatagatgacgcataaacaaagtaacaaatttttttgtacaaagaaaatattttttattcaaga |
8236019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 8448437 - 8448493
Alignment:
| Q |
136 |
ttttggttgtccatgaaacaacatgtatgagatcgtttatgtaagtcagtatgaaaa |
192 |
Q |
| |
|
||||||||| | |||||||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
8448437 |
ttttggttgccaatgaaacaacatgtataagatcttttatgtttgtcagtatgaaaa |
8448493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University