View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13971_low_9 (Length: 211)
Name: NF13971_low_9
Description: NF13971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13971_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 167
Target Start/End: Complemental strand, 40652367 - 40652218
Alignment:
| Q |
18 |
gcataggatgaaatggtctaggaggaggggaaaacccagttgtcttattccttgagcgagtagggctagttgagaacgaaccactctttcgagacatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652367 |
gcataggatgaaatggtctaggaggaggtgaaaacccagttgtcttattccttgagcgagtagggctagttgagaacgaaccactctttcgagacatttt |
40652268 |
T |
|
| Q |
118 |
gcgttaactttgttattgagtactatagctgaatacaaatcaaatgttag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652267 |
gcgttaactttgttattgagtactatagctgaatacaaatcaaatgttag |
40652218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University