View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13972_low_6 (Length: 239)
Name: NF13972_low_6
Description: NF13972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13972_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32424409 - 32424195
Alignment:
| Q |
1 |
tggaacacattgttatattcattaaccacatatgtgaaccatgtcagccatctagattattgtggaattttgatgtaaattggtgtatcaaaatataaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32424409 |
tggaacacattgttatattcattaaccacatatgtgaaccatgtcagccatctagattattgtggaattttgatgtaaattggtgtttcaaaatataaat |
32424310 |
T |
|
| Q |
101 |
tctattatgtaacatcatatatattccaatagaacacaatgataacatactatactcttcattagagtgatttaattgatctataaagggttatatggtt |
200 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32424309 |
tctatcatgtaacatc----atattccaataga--acaatgataccgtactatcctcttcattagagtgatttaattgatctataaagggttatatggtt |
32424216 |
T |
|
| Q |
201 |
gttggaatttacagctaggag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32424215 |
gttggaatttacagctaggag |
32424195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University