View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13972_low_8 (Length: 227)
Name: NF13972_low_8
Description: NF13972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13972_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 227
Target Start/End: Complemental strand, 24714042 - 24713819
Alignment:
| Q |
4 |
tcatagtggtgaggcaaaccttgtgaatttgcagcatttgcagactcagtttaatcctaccatgatgttaatctatcatggtcacagtgatagatttagc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24714042 |
tcatagtggtgaggcaaaccttgtgaatttgcagcatttgcagactcagtttaatcctaccatgatgttaatctatcatggtcacagtgatagatttagc |
24713943 |
T |
 |
| Q |
104 |
tatgtccttgcattgtttaaggttataattcacatcaaaaataaaataaatgtatttattaatattttgttgattgatattgatgtactaatacttgtat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24713942 |
tatgtccttgcattgtttaaggttataattcacatcaaaaataaaataaatgtatttattaatattttgttgattgatattgatgtactaatatttgtat |
24713843 |
T |
 |
| Q |
204 |
ttaaattatgatttaacttcttca |
227 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
24713842 |
taaaattatgatttaacttcttca |
24713819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University