View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13972_low_9 (Length: 215)
Name: NF13972_low_9
Description: NF13972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13972_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 53 - 197
Target Start/End: Complemental strand, 31917902 - 31917758
Alignment:
| Q |
53 |
gttgaaccaagttacattgacctaagttctgactgtcaaataattaagggtctaagcctgatccattttgaatgatttatatgtcatgttagcatgttta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31917902 |
gttgaaccaagttacattgacctaagttctgactgtcaaataattaagggtctaagcctgatccatttcgaatgatttatatgtcatgttagcatgttta |
31917803 |
T |
 |
| Q |
153 |
gcctatttcatatgaacatatttaatgagtaattatgtgaatgtt |
197 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
31917802 |
acctattttatatgaacatatttaacaagtaattatgtgaatgtt |
31917758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 31922190 - 31922152
Alignment:
| Q |
137 |
catgttagcatgtttagcctatttcatatgaacatattt |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31922190 |
catgttagcatgtttagctcatttcatatgaacatattt |
31922152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University