View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13973_low_2 (Length: 246)
Name: NF13973_low_2
Description: NF13973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13973_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 128 - 239
Target Start/End: Original strand, 16827626 - 16827737
Alignment:
| Q |
128 |
tttaatgattctaagctgtctttattttacttctgtctgataattgatctttctggaactacatgttaacattagtataattatgacctcttttagagaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16827626 |
tttaatgattctaagctgtctttattttacttctgtctgataattgatctttctggaactacatgttaacattagtataattatgacctgttttagagaa |
16827725 |
T |
|
| Q |
228 |
gggatgatgtcc |
239 |
Q |
| |
|
||| |||||||| |
|
|
| T |
16827726 |
gggttgatgtcc |
16827737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 128 - 239
Target Start/End: Original strand, 29240090 - 29240201
Alignment:
| Q |
128 |
tttaatgattctaagctgtctttattttacttctgtctgataattgatctttctggaactacatgttaacattagtataattatgacctcttttagagaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29240090 |
tttaatgattctaagctgtctttattttacttctttctgataatcgatctttctggaactacatgttaacattagtataattatgacctcttttagagaa |
29240189 |
T |
|
| Q |
228 |
gggatgatgtcc |
239 |
Q |
| |
|
||| |||||||| |
|
|
| T |
29240190 |
gggttgatgtcc |
29240201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University