View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13974_high_12 (Length: 233)
Name: NF13974_high_12
Description: NF13974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13974_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 4675736 - 4675529
Alignment:
| Q |
10 |
taacaattatttaacaacacaatgtactactcatagtcctaattgcaggatcaatcaaccaatttaatacaatttgaatcatataacaaattcaaaataa |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4675736 |
taacaattatataacaacacaatgtactactcatagtcctaattgcaggatcaatcaaccaatttaatacaatttgaatcatataacaaattcaaaataa |
4675637 |
T |
 |
| Q |
110 |
aaaatagatattcattacgcgttgttttcttggatggtttcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgataga |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4675636 |
aaaatagatattcattacgtgttgttttcttggatggtttcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgataga |
4675537 |
T |
 |
| Q |
210 |
gagatagt |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
4675536 |
gagatagt |
4675529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University