View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13974_high_14 (Length: 225)
Name: NF13974_high_14
Description: NF13974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13974_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 2875834 - 2876030
Alignment:
| Q |
13 |
gagatgaagaaagaaataaaccttaggcctaataaagaatacgccgataggatgaactaataaggttgaggaaagacatggagacggctcatgaaccatg |
112 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2875834 |
gagataaagaaagaaataaacctaagtcctaataaagaacacgccgataggatgaactactaaggttgaggaaagacatggaggcggctcatgaaccatg |
2875933 |
T |
 |
| Q |
113 |
atcaaggtatctgtaaaattaactccaaattttgctagaatacaagtattacccacccaaaagcgttgttgagggtaaaattataatcattctttat |
209 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2875934 |
atcaaggtatccgtaaaattagctccaaattttgctagaatacaagtattacccacccaaaagcgtggttgagggtaaaattataatcattctttat |
2876030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University