View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13974_low_15 (Length: 233)

Name: NF13974_low_15
Description: NF13974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13974_low_15
NF13974_low_15
[»] chr8 (1 HSPs)
chr8 (10-217)||(4675529-4675736)


Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 4675736 - 4675529
Alignment:
10 taacaattatttaacaacacaatgtactactcatagtcctaattgcaggatcaatcaaccaatttaatacaatttgaatcatataacaaattcaaaataa 109  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4675736 taacaattatataacaacacaatgtactactcatagtcctaattgcaggatcaatcaaccaatttaatacaatttgaatcatataacaaattcaaaataa 4675637  T
110 aaaatagatattcattacgcgttgttttcttggatggtttcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgataga 209  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4675636 aaaatagatattcattacgtgttgttttcttggatggtttcctggaaggctacccgtggagttttacaaggaggtggaagggaagatgggagacgataga 4675537  T
210 gagatagt 217  Q
    ||||||||    
4675536 gagatagt 4675529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University