View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_101 (Length: 221)
Name: NF13975_high_101
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 49962803 - 49962614
Alignment:
| Q |
14 |
caaagggatcaaacttgtagtacgcaagcgcgcgcacacaaagagacacgtatcttcaaaatataagactattatttattataattattagaaaaatggc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49962803 |
caaagggatcaaacttgtagtacgcaagcgctcacacacaaagagacacgtatcttcaaaatataagattattatttattataattattagaaaaatggc |
49962704 |
T |
|
| Q |
114 |
tcttttgtgtgtgtctttaacactaaacatttggtcatttgactatataagaattgctctgtctttatattagtttttagatgcacttggt |
204 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49962703 |
tattttgtgtgtgtc-ttaacactaaacatttggtcatttgactatacaagaattgctctgtctttatattagtttttagatgcacttggt |
49962614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University