View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_55 (Length: 324)
Name: NF13975_high_55
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 46184998 - 46185189
Alignment:
| Q |
1 |
cggaccgggttgattatgcaaggaaccgcctttatgatactgcttctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184998 |
cggaccgggttgattatgcaaggaaccgcctttatgatactgcttctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaa |
46185097 |
T |
|
| Q |
101 |
ggatgcagctcctggtgcttgattgaaccaaaccggttc--------ggttggttcactagcttatactatcatatatttatattcaaccgg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185098 |
ggatgcagctcctggtgcttgattgaaccaaaccggttcggttggttggttggttcactagcttatactatcatatatttatattcaaccgg |
46185189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 207 - 315
Target Start/End: Original strand, 46185227 - 46185335
Alignment:
| Q |
207 |
atgtatggttcaaaattaagttaaggtgtgtgtacgtaatcataattgttagtggaattaagttatgtcatctttatattcttttgttacttttttggtc |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185227 |
atgtatggttcaatattaagttaaggtgtgtgtacgtaatcataattgttagtggaattaagttatgtcatctttatattcttttgttacttttttggtg |
46185326 |
T |
|
| Q |
307 |
tgtgctgct |
315 |
Q |
| |
|
|||| |||| |
|
|
| T |
46185327 |
tgtgatgct |
46185335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University