View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_73 (Length: 256)
Name: NF13975_high_73
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 97 - 240
Target Start/End: Original strand, 40492701 - 40492844
Alignment:
| Q |
97 |
aagttaaaatagtatgaaaccaacctttgctgcacaggtggaataccctctttttcttcaacacgttccttgatacgatcaatagtatcagtaggctcaa |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40492701 |
aagttaaaatagtatgaaaacaacctttgctgcacaggtggaataccctctttttcttcaacacgttccttgatacgatcaatagtatcagtaggctcaa |
40492800 |
T |
 |
| Q |
197 |
tgtcaatttcaatctctttaccagtcaaagtcttgactttaatc |
240 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40492801 |
tgtcaatttcaatctctttaccggtcaaagtcttgactttaatc |
40492844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 73
Target Start/End: Original strand, 40492628 - 40492685
Alignment:
| Q |
16 |
ctaaaaacagacctacattaaccttatcatgaaggtgcatagaacaaaagttatcaac |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40492628 |
ctaaaaacagacctacattaaccttatcatgaaggtgcatagaacaaaagttatcaac |
40492685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 118 - 240
Target Start/End: Complemental strand, 27909783 - 27909661
Alignment:
| Q |
118 |
aacctttgctgcacaggtggaataccctctttttcttcaacacgttccttgatacgatcaatagtatcagtaggctcaatgtcaatttcaatctctttac |
217 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| ||||| | |
|
|
| T |
27909783 |
aacctctgctgcacaggtggaattccttctttttcttcaacacgctccttgatacgatcaattgtatcagttggctcaatgtcaatttcaatttcttttc |
27909684 |
T |
 |
| Q |
218 |
cagtcaaagtcttgactttaatc |
240 |
Q |
| |
|
|||| |||||||| ||||||||| |
|
|
| T |
27909683 |
cagttaaagtcttcactttaatc |
27909661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University