View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_74 (Length: 253)
Name: NF13975_high_74
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 48 - 154
Target Start/End: Complemental strand, 40567101 - 40566995
Alignment:
| Q |
48 |
tacaacgatatgtgtcaataatatgatccaatgatatggccccattcaaggttcatagcatataattttttctcatgggagacaattagagatgagaatc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40567101 |
tacaacgatatgtgtcaataatatgatccaatgatatggccccattcaaggttcatagcatagaattttttctcatgggagacaattagagatgagaatc |
40567002 |
T |
 |
| Q |
148 |
atacctt |
154 |
Q |
| |
|
||||||| |
|
|
| T |
40567001 |
atacctt |
40566995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 40567001 - 40566954
Alignment:
| Q |
192 |
atacctttgatgatcatttactcctttagttgattagcttagtataat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40567001 |
atacctttgatgatcatttactcctttagttgattagcttagtataat |
40566954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University