View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_79 (Length: 249)
Name: NF13975_high_79
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_79 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 227271 - 227032
Alignment:
| Q |
14 |
atatacgaaaaagtaattaatgaggttgactagttaagttccacaaagcgcttggaaggaaggaag----tttgaaaaggaaggagaagagttagat--- |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
227271 |
atatacgaaaaagtaattaatgaggttgactagttaagttccacaaagcgcttggaaggaaggaaggaagtttgaaaagga----gaagagttagataga |
227176 |
T |
|
| Q |
107 |
-tagattagatggagaaagcggtgagagcatacgcagaagttctgagacttgtgcggcgtttaccaaaggattcaagaggttattatgctaagtacgctc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
227175 |
ttagattagatggagaaagcggtgagagcatacgcagaagttctgagacttgtgcggcgtttaccaaaggattcaagaggttattatgctaagtacgctc |
227076 |
T |
|
| Q |
206 |
gcgagaacttcgttaattaccgtgaggttgatccttctgattcc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
227075 |
gcgagaacttcgttaattaccgtgaggtcgatccttctgattcc |
227032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University