View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_high_85 (Length: 242)
Name: NF13975_high_85
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_high_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 44326742 - 44326669
Alignment:
| Q |
1 |
tcaagtcttttgttgattattgattttggtgtgttcggtctaaagatatattttgattgagggactaaattgtt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44326742 |
tcaagtcttttgttgattattgattttggtgagttcggtctaaagatatattttgattgcgggactaaattgtt |
44326669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 151
Target Start/End: Complemental strand, 44326682 - 44326617
Alignment:
| Q |
86 |
gggattaatttgttattgagggattaaattgctcaaactttacaacataccaatttagttccttta |
151 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44326682 |
gggactaaattgttattgagggattaaattgctcaaactttacaacataccaatttagttccttta |
44326617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 44326555 - 44326489
Alignment:
| Q |
163 |
ttgcaaagttgccactaccattttcaactttatgttcttattcaagttaatatggaagtcttatatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
44326555 |
ttgcaaagttgccactaccattttcaacgttatatgcttattcaagttaatatggaagtcttatatt |
44326489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University