View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_104 (Length: 232)

Name: NF13975_low_104
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_104
NF13975_low_104
[»] chr2 (1 HSPs)
chr2 (1-216)||(29672576-29672791)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 29672576 - 29672791
Alignment:
1 gtcgaagaagcggtgaccggctactggctcgtaaagtggattggcgccgttacggaggtaaacaccgtcaatgttggttgggattttgccggtaattgga 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29672576 gtcgaagaagtggtgaccggctactggctcgtaaagtggattggcgccgttacggaggtaaacaccgtcaatgttggttgggattttgccggtaattgga 29672675  T
101 agagattgggttaccgggtgttccggtactggggcgaagttaccggcaatttggacacgtgggtcggaggtttttggtagtgggtgtttctgttcttgtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||    
29672676 agagattgggttaccgggtgttccggtactggggcgaagttaccggcaatttgaacacgtgggtcggaggttttgggtagtgggtgtttttgttcttgtt 29672775  T
201 tgattaaggttgtttc 216  Q
    ||||||||||||||||    
29672776 tgattaaggttgtttc 29672791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University