View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_104 (Length: 232)
Name: NF13975_low_104
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_104 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 29672576 - 29672791
Alignment:
| Q |
1 |
gtcgaagaagcggtgaccggctactggctcgtaaagtggattggcgccgttacggaggtaaacaccgtcaatgttggttgggattttgccggtaattgga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672576 |
gtcgaagaagtggtgaccggctactggctcgtaaagtggattggcgccgttacggaggtaaacaccgtcaatgttggttgggattttgccggtaattgga |
29672675 |
T |
|
| Q |
101 |
agagattgggttaccgggtgttccggtactggggcgaagttaccggcaatttggacacgtgggtcggaggtttttggtagtgggtgtttctgttcttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29672676 |
agagattgggttaccgggtgttccggtactggggcgaagttaccggcaatttgaacacgtgggtcggaggttttgggtagtgggtgtttttgttcttgtt |
29672775 |
T |
|
| Q |
201 |
tgattaaggttgtttc |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29672776 |
tgattaaggttgtttc |
29672791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University