View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_106 (Length: 226)
Name: NF13975_low_106
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_106 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 51 - 212
Target Start/End: Original strand, 37588160 - 37588321
Alignment:
| Q |
51 |
agaaacaacttctatattgcctttgatttactcttacccttcttttattttatgctgagttcaactttttacaggaggaaatacactgttattgatagtt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
37588160 |
agaaacaacttctatattgcctttgatttactcttacccttcttttattttatggtgagtttaactttttaccggaagaaatacactgttattgatagtt |
37588259 |
T |
|
| Q |
151 |
tctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttcatctca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588260 |
tctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttcatctca |
37588321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 33722010 - 33722065
Alignment:
| Q |
140 |
tattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacat |
196 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33722010 |
tattgatagtttctgctatttttctttta-tgtcagatttctatctattgtgaacat |
33722065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University