View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_108 (Length: 219)
Name: NF13975_low_108
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_108 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 33626162 - 33625978
Alignment:
| Q |
17 |
atttatgaatctcagaattaattagtttagctcgttgctggatcagcaactaatttataggataaggggttgcacttgcattgtcttttgctaattgggc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33626162 |
atttatgaatctcataattaattagtttagctcgttgctggatcagcaactaatttataggataaggggttgcacttgcattgtcttttgctaattgggc |
33626063 |
T |
|
| Q |
117 |
caatgtgaatgaaatagactataggattaactatcttaattttttatatagaagaaagaatttgtcattctattaggcagtattctt |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33626062 |
caatgtgaatgaaatagac--taggattaactatcttaattttttatatagaagaaagaatttgtcattctattaggcagtattctt |
33625978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University