View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_110 (Length: 211)

Name: NF13975_low_110
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_110
NF13975_low_110
[»] chr1 (1 HSPs)
chr1 (57-189)||(38332304-38332435)
[»] chr7 (1 HSPs)
chr7 (129-193)||(41482421-41482484)
[»] chr4 (1 HSPs)
chr4 (129-177)||(2183362-2183409)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 57 - 189
Target Start/End: Original strand, 38332304 - 38332435
Alignment:
57 tttggttggagtttcggagaatatggagaatagtgatgatagtgtgttttgtttgtggagatttgtcttttcctatcagattgctaacccgtccaaaaat 156  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
38332304 tttggttggagtttcagagaatatgaagaatagtgatgatagtgtgttttgtttgtggagatttgtcttttcctatcagattgctaaccc-tccaaaaat 38332402  T
157 taaagataaaaataacaaaggatgagtatgatt 189  Q
    |||||||||||||||||||||| ||||||||||    
38332403 taaagataaaaataacaaaggacgagtatgatt 38332435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 193
Target Start/End: Original strand, 41482421 - 41482484
Alignment:
129 ctatcagattgctaacccgtccaaaaattaaagataaaaataacaaaggatgagtatgatttgat 193  Q
    ||||||| ||||||||||  ||||||| ||| ||||||||||||||||| |||||| ||| ||||    
41482421 ctatcaggttgctaaccca-ccaaaaactaaggataaaaataacaaagggtgagtaggatatgat 41482484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 177
Target Start/End: Complemental strand, 2183409 - 2183362
Alignment:
129 ctatcagattgctaacccgtccaaaaattaaagataaaaataacaaagg 177  Q
    ||||||| ||||||||||  ||||||||||| |||||||||||||||||    
2183409 ctatcaggttgctaaccca-ccaaaaattaaggataaaaataacaaagg 2183362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University