View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_110 (Length: 211)
Name: NF13975_low_110
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_110 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 57 - 189
Target Start/End: Original strand, 38332304 - 38332435
Alignment:
| Q |
57 |
tttggttggagtttcggagaatatggagaatagtgatgatagtgtgttttgtttgtggagatttgtcttttcctatcagattgctaacccgtccaaaaat |
156 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38332304 |
tttggttggagtttcagagaatatgaagaatagtgatgatagtgtgttttgtttgtggagatttgtcttttcctatcagattgctaaccc-tccaaaaat |
38332402 |
T |
|
| Q |
157 |
taaagataaaaataacaaaggatgagtatgatt |
189 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
38332403 |
taaagataaaaataacaaaggacgagtatgatt |
38332435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 193
Target Start/End: Original strand, 41482421 - 41482484
Alignment:
| Q |
129 |
ctatcagattgctaacccgtccaaaaattaaagataaaaataacaaaggatgagtatgatttgat |
193 |
Q |
| |
|
||||||| |||||||||| ||||||| ||| ||||||||||||||||| |||||| ||| |||| |
|
|
| T |
41482421 |
ctatcaggttgctaaccca-ccaaaaactaaggataaaaataacaaagggtgagtaggatatgat |
41482484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 177
Target Start/End: Complemental strand, 2183409 - 2183362
Alignment:
| Q |
129 |
ctatcagattgctaacccgtccaaaaattaaagataaaaataacaaagg |
177 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
2183409 |
ctatcaggttgctaaccca-ccaaaaattaaggataaaaataacaaagg |
2183362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University