View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_111 (Length: 204)

Name: NF13975_low_111
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_111
NF13975_low_111
[»] chr5 (1 HSPs)
chr5 (10-188)||(4395290-4395467)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 4395467 - 4395290
Alignment:
10 tgagatgaaccaaaacaattatttgtnnnnnnnctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc 109  Q
    ||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4395467 tgagatgaaccaaaacaattatttgtaaaaaa-ctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc 4395369  T
110 cgggtcaaatgggtttgtttcttaattgaagtaatggtgagccatatgagtgatttattctagtagtatacgcaatatg 188  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
4395368 cgggtcaaacgggtttgtttcttaattgaagttatggtgagccatatgagtgatttatactagtagtatacgcaatatg 4395290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University