View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_111 (Length: 204)
Name: NF13975_low_111
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_111 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 4395467 - 4395290
Alignment:
| Q |
10 |
tgagatgaaccaaaacaattatttgtnnnnnnnctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395467 |
tgagatgaaccaaaacaattatttgtaaaaaa-ctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc |
4395369 |
T |
 |
| Q |
110 |
cgggtcaaatgggtttgtttcttaattgaagtaatggtgagccatatgagtgatttattctagtagtatacgcaatatg |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4395368 |
cgggtcaaacgggtttgtttcttaattgaagttatggtgagccatatgagtgatttatactagtagtatacgcaatatg |
4395290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University