View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_81 (Length: 250)
Name: NF13975_low_81
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 36275317 - 36275538
Alignment:
| Q |
14 |
gacgaagacgtggataacatgatagacgaatacgaccgcgtcacacagagtgaaaacccacgagcagctcgtcttcgtctcttccttttcccagaaggag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275317 |
gacgaagacgtggataacatgatagacgaatacgaccgcgtcacacagagtgaaaacccacgagcagctcgtcttcgtctcttccttttcccagaaggag |
36275416 |
T |
 |
| Q |
114 |
aagattcacgaaccaacagtatcagttcactcttaaacggttcatctaaaagagaaaactggttcatggatgctttaaacggtggcgtttcgggtttaga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36275417 |
aagattcacgaaccaacagtatcagttcactcttaaacggttcatctaaaagagaaaactggttcatggatgctttaaacggtggcgtttctggtttaga |
36275516 |
T |
 |
| Q |
214 |
acgaggaagatcagaagcttct |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36275517 |
acgaggaagatcagaagcttct |
36275538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University