View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13975_low_91 (Length: 240)
Name: NF13975_low_91
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13975_low_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 19055621 - 19055561
Alignment:
| Q |
117 |
tcgtacctacagtagtcaacaagtaaaagaaatacttgttgcaactcgtcgtcgtgtcttc |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19055621 |
tcgtacctaccgtagtcaacaagtaaaagaaatacttgttgcaactcgtcgtcgcgtcttc |
19055561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University