View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_91 (Length: 240)

Name: NF13975_low_91
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_91
NF13975_low_91
[»] chr4 (1 HSPs)
chr4 (117-177)||(19055561-19055621)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 19055621 - 19055561
Alignment:
117 tcgtacctacagtagtcaacaagtaaaagaaatacttgttgcaactcgtcgtcgtgtcttc 177  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||    
19055621 tcgtacctaccgtagtcaacaagtaaaagaaatacttgttgcaactcgtcgtcgcgtcttc 19055561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University