View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_high_56 (Length: 222)
Name: NF13978_high_56
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 51756921 - 51756745
Alignment:
| Q |
16 |
cactgatgtagagttgtgggaatcttattacaattagtatataccaacagtaaatttcatccgtcagctggtggtgttacaagttaatttgttatattcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51756921 |
cactgatgtagagttgtgggaatcttattacaattagtat-taccaacagtaaatttcatccgtcagctggtggtgttacaagtt----tgttatattcg |
51756827 |
T |
 |
| Q |
116 |
gcaatagacaagttattgagtctgaaacagacattttagttagcatcgtccatttgatggaaccatgtgcgactgtgaccac |
197 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51756826 |
gcaatagacaaattattgagtctgaaacagacattttagttagcatcgtccatttgatggaaccatgtgcgactgtgaccac |
51756745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University