View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_15 (Length: 393)
Name: NF13978_low_15
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 19 - 383
Target Start/End: Original strand, 42929297 - 42929661
Alignment:
| Q |
19 |
caagaatccaaacaagttgattcgatcgaaactgtgattcgtggattatcttctgatcggtttttctttgagccagatgagaccaactccattttagagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42929297 |
caagaatccaaacaagttgattcgatcgaaactgtgattcgtggattatcttctgatcggtttttctttgagccagatgagaccaactccatcttagagg |
42929396 |
T |
|
| Q |
119 |
ttaataataaagctgctgcaattggaggtggtgaaactcaaagcttgccattcaaagatagtgtagttttatctatggaatctcgagatccttatgtcga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929397 |
ttaataataaagctgctgcaattggaggtggtgaaactcaaagcttgccattcaaagatagtgtagttttatctatggaatctcgagatccttatgtcga |
42929496 |
T |
|
| Q |
219 |
ttttcgaaagtctatggaggaaatagtagaagctcacgatgttaaagattgggaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929497 |
ttttcgaaagtctatggaggaaatagtagaagctcacgatgttaaagattgggaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaa |
42929596 |
T |
|
| Q |
319 |
atcaatcatggctatattgttggtgcttttgttgatttattggttggtcttacatattcttcgac |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
42929597 |
atcaatcatggctatattgttggtgcttttgttgatttattggttggtcttacatttgcttcgac |
42929661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 262 - 356
Target Start/End: Complemental strand, 50463383 - 50463289
Alignment:
| Q |
262 |
aaagattgggaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgattt |
356 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||||||||||||| || |||| |||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
50463383 |
aaagattgggatggtttggaagagcttttgagttggtatttgaaagttaatggtaaaaataatcatgggtttattgttggtgcttttgttgattt |
50463289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 284 - 359
Target Start/End: Complemental strand, 25531099 - 25531024
Alignment:
| Q |
284 |
agcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgatttatt |
359 |
Q |
| |
|
||||||||||||||||||| | || |||||||||| |||||||| | |||| ||| ||||||| |||||||||| |
|
|
| T |
25531099 |
agcttttgagttggtattttgaagttaatgagaaaagaaatcatggatttattattgatgctttttttgatttatt |
25531024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University