View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_22 (Length: 341)
Name: NF13978_low_22
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 8668267 - 8668388
Alignment:
| Q |
99 |
acaactaaaaccacaatatttaaaatagggggtgatagaaggggaggttctgatgtaccagatccggcttttaaatggccaaaaacgaaatgaggaggag |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8668267 |
acaactaaaaccacaatctttaaaatagggggtgacagaaggggaggttctgatgtaccagattcggcttttagatggccaaaaaagaaatgaggaggag |
8668366 |
T |
 |
| Q |
199 |
agattccggtggagggaggtat |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8668367 |
agattccggtggagggaggtat |
8668388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 11 - 104
Target Start/End: Original strand, 8649824 - 8649917
Alignment:
| Q |
11 |
caaagggataaagatgaagccaagcaacatattgaattgaaaatactagatctggcataaaaaactatgaaagctagtaaaacaacaaacaact |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
8649824 |
caaagggataaagatgaagccaaacaacagattgaattgaaaatactagatctggaagaagaaactatgaaagctagtaaaacaacaaacaact |
8649917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University